This subproject is one of many research subprojects utilizing the resources provided by a Center grant funded by NIH/NCRR. The subproject and investigator (PI) may have received primary funding from another NIH source, and thus could be represented in other CRISP entries. The institution listed is for the Center, which is not necessarily the institution for the investigator. Previous work from our laboratory has been aimed at establishing an experimental basis for adeno-associated viral (AAV) vector-mediated gene transfer as an approach to treating hemophilia. Based on long-term cure of hemophilia in the canine model of the disease, we undertook a clinical trial in which subjects with severe hemophilia B were infused via the hepatic artery with an AAV vector encoding coagulation factor IX (AAV-F.IX). One subject in the high-dose cohort achieved circulating F.IX levels of 11.8% (therapeutic range) by the second week after vector infusion. These levels were sustained for approximately four weeks and then began gradually to fall, eventually returning to the subject s baseline level of less than 1%. Coincident with the fall in F.IX levels, the liver transaminase enzymes in the blood began to rise, peaking at 5 weeks after infusion, and declining to normal several weeks thereafter. Thus, the patient pursued a course quite different from that seen in experimental animals, including mice, rats, rabbits, hemophilic dogs, and non-human primates. We hypothesized that memory T cells generated from a previous, natural infection with AAV, were activated with vector infusion and were responsible for the elimination of transduced cells, which resulted in a transaminitis and a decline in circulating F.IX levels. Stated simply, the goal of this project is to understand how previously acquired immunity to AAV may affect the outcome of AAV-mediated gene transfer. We have chosen to do experiments in primates using an AAV serotype 8 (AAV-8) vector because AAV-8 was originally isolated from the simian population, and some nonhuman primates have detectable titers of anti-AAV-8 antibodies, suggesting prior infection. Using animals with and without detectable immune responses to AAV-8 at baseline, we will examine responses to hepatic artery infusion of an AAV-8-hF.IX vector. This situation will model to some extent the conditions in humans, in that some animals will have pre-existing immunity to the vector capsid.
AIM : We wanted to screen the F.IX gene in a population of Rhesus monkeys to make sure that the recognition sequence of the Mab 9.9, amino acids 147-153, is 100% conserved between humans and Rhesus. This will us to engineer a Rhesus F.IX construct that will be used to distinguish between endogenous F.IX and the transgene product, yet should be non-immunogenic in the Rhesus. METHODS: The area of the Rhesus F.XI gene spanning the Ala/Thr polymorphism was amplified by PCR. For the amplification, a forward (5 TGCCATTTCCATGTGGAAGA3 ) and a reverse (5 AAGGGAATTGACCTGGTTTG3 ) primers were used. PCR conditions were as follow: denaturation at 94oC for 30 , annealing at 53oC for 20 , and extension at 68oC for 30 , 30 cycles. PCR product was digested with HpyCH4III restriction enzyme (New England Biolabs) and ran on a 2% agarose gel. Some of the results were also confirmed by DNA sequencing. RESULTS: DNA was isolated and analyzed in 20 animals. All the animals (100%) screened showed the presence of the codon encoding for Thr in position 148 of F.IX. These results suggest that the site is not polymorphic, however a larger number of animals will be screened to confirm the result.
Showing the most recent 10 out of 365 publications
