The major goal of the work outlined in this proposal is to use two- and three-dimensional NMR spectroscopy to solve the structures of DNA oligonucleotides containing telomere repeat sequences. Specific experimental approaches and systems will include: 1.Determine the structures of the oligonucleotides containing the telomere repeat sequences from: Oxytricha[d(GGGGTTTTGGGGTTTTGGGGTTTTGGGG)], Tetrahymena[d(GGGGTTGGGGTTGGGGTTGGGG)], Chlamydomonas[d(AGGGTTTTAGGGTTTTAGGGTTTTAGGG)], Arabidopsis[d(AGGGTTTAGGGTTTAGGGTTTAGGG)], Homo sapiens[d(AGGGTTAGGGTTAGGGTTAGGG)]. These oligonucleotides can all potentially fold to form intramolecular quadruplexes or other structures with G-G base pairs. 2.Compare the results obtained above to those obtained with the corresponding oligonucleotides which could form quadruplexes either by dimerization of hairpins or tetramerization: Oxytricha [d(GGGGTTTTGGGG)], Tetrahymena [d(GGGGTTGGGG)], Chlamydomonas [d(AGGGTTTTAGGG)], Arabidopsis [d(AGGGTTTAGGG)], and Homo sapiens [d(AGGGTTAGGG)]. These may also form unique non-quadruplex structures such as intramolecular hairpins. 3.Investigate the effect of cations on formation and stability of the structures formed by these oligonucleotides and interconversions between structures. 4.Investigate the structures formed by oligonucleotides containing the duplex telomere repeat sequences. The ultimate object of this work is to elucidate the role of alternative DNA structures in the function of the telomere. In addition, since these types of repeating G-rich sequences also occur in control regions within the chromosome, these studies may also reveal something about alternative DNA structures in gene promoters, immunoglobulin switch regions, and other important control regions.
Showing the most recent 10 out of 38 publications
