This proposal addresses mechanisms responsible for regulating expression of the DF3 glycoprotein, a differentiation antigen which is aberrantly expressed in malignant breast epithelial cells. Monoclonal antibody (MAb) DF3 detects a family of mucin-like glycoproteins with high molecular weights (300-500 kD) which are expressed in a polymorphic fashion. Immunoperoxidase staining with MAb DF3 distinguishes malignant and benign breast lesions. DF3 antigen is detectable on the apical borders of secretory mammary epithelial cells and is over-expressed in the cytosol in less differentiated malignant cells. Circulating DF3 antigen levels can be used to monitor the clinical course of breast cancer patients. The level of DF3 antigen expression has also been shown to correlate with degree of breast tumor differentiation. The cDNA encoding the DF3 protein has been cloned as well as 1.6 kb upstream to the transcription start site. A large proportion of the cDNA is occupied by GC-rich 60 bp tandem repeats. These repeats code for 20 amino acid tandems rich in serine, threonine, proline, alanine and glycine. Polymorphic expression of DF3 antigen results from genes containing variable number of tandem repeats. Previous studies have demonstrated that DF3 gene expression is regulated at the transcriptional level. I have recently identified an element located at position -505 to -485 in the DF3 promoter that is functional in regulating DF3 gene transcription. this element functions in both orientations in DF3 promoter and enhancer constructs. This sequence 5'- (GGGAAGTGGTGGGGGGAGGGA) has not been previously described as a cis- element. Moreover, I have found that this sequence specifically interacts with a 45 kD nuclear protein. The objectives of this proposal are to further define the regulatory mechanisms of DF3 gene transcription, characterize the regulatory proteins and study the involvement of these proteins in the aberrant expression of DF3 antigen.
The specific aims are: 1) to further define the sequences which bind to nuclear protein(s) that regulate DF3 transcription; 2) to determine the nuclear protein(s) which bind to functional cis-elements that regulate DF3 transcription; 3) to clone the gene(s) coding for DF3 regulatory nuclear protein(s); 4) to determine whether levels of DF3 regulatory protein(s) correspond with aberrant expression of DF3 antigen in human mammary epithelial cells.
